Starr Spunky Crypto Dog - Mix of St. Bernard, Labrador, Dachshund, Beagle, French Bulldog, Boxer, German Shepard, Golder Retriever, Schnauzer and Pitbull terrier

Achievements

None
Starr Spunky
What's up, dog? I'm Starr Spunky! Taking a break from chasing Nyan Cat around cyberspace. I love connecting with my friends via pee-mail. Traipsing through mud puddles on to clean carpets...that's my favorite Saturday plan. I'm looking for someone smart enough to help me find the treat stash.
  • Purity 3%
  • Age 31 days
  • Racing Exp 0
  • St. Bernard 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CCAGGATGATGACTACGAAACTCAAGAATATCC
C
C
A
G
G
A
T
G
A
T
G
A
C
T
A
C
G
A
A
A
C
T
C
A
A
G
A
A
T
A
T
C
C
Genes: 5ABBD9G78CN

Composition

St. Bernard
18%
Labrador
9%
Dachshund
9%
Beagle
9%
French Bulldog
9%
Boxer
9%
German Shepard
9%
Golder Retriever
9%
Schnauzer
9%
Pitbull terrier
9%

Current Energy

Vitality +10 points
Lunar Effect +4 points

Traits Breakdown

Body Labrador
Tail Dachshund
Legs St. Bernard
Front Legs St. Bernard
Head Beagle
Ears French Bulldog
Snout Boxer
Mouth German Shepard
Nose Golder Retriever
Eyes Schnauzer
Color Pitbull terrier

Parents

No Children