Daisey-Mae Dynamite Crypto Dog - Mix of Golder Retriever, Dachshund, Border Collie, Husky, Boxer, Labrador BK, French Bulldog, Labrador, Schnauzer, Beagle and Maltese

Achievements

None
Daisey-Mae Dynamite
What's up, dog? I'm Daisey-Mae Dynamite! Taking a break from chasing Nyan Cat around cyberspace. I love connecting with my friends via pee-mail. Traipsing through mud puddles on to clean carpets...that's my favorite Saturday plan. I'm looking for someone smart enough to help me find the treat stash.
  • Purity 0%
  • Age 4 months
  • Racing Exp 0
  • Mixed-breed
  • 0 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AGAGGATACACAAACGCACGACCAATACTAACC
A
G
A
G
G
A
T
A
C
A
C
A
A
A
C
G
C
A
C
G
A
C
C
A
A
T
A
C
T
A
A
C
C
Genes: 8AJ4G695CDK

Composition

Golder Retriever
9%
Dachshund
9%
Border Collie
9%
Husky
9%
Boxer
9%
Labrador BK
9%
French Bulldog
9%
Labrador
9%
Schnauzer
9%
Beagle
9%
Maltese
9%

Current Energy

Vitality -17 points
Lunar Effect +4 points

Traits Breakdown

Body Golder Retriever
Tail Dachshund
Legs Border Collie
Front Legs Husky
Head Boxer
Ears Labrador BK
Snout French Bulldog
Mouth Labrador
Nose Schnauzer
Eyes Beagle
Color Maltese