Rambo Rockwell Crypto Dog - Mix of Boxer, Schnauzer, Yorkshire Terrier, German Shepard, Shiba Inu, Beagle, Labrador, French Bulldog, Rottweiler and Border Collie

Achievements

Racer
Rambo Rockwell
Rambo Rockwell here. Wanna play? I am on a mission to sniff all the butts in the world. ALL the butts. Ultimate Frisbee is my favorite sport. I haven't really mastered the throwing part yet, but I have the catching part down! I'll be mostly faithful to you...if we can agree on a bootie-pass for that Taco Bell dog!
  • Purity 1%
  • Age 33 days
  • Racing Exp 21
  • Boxer 18%
  • 9 races
  • Gen 0
Share it to make him Happy!
Sad & Slothful
Energy: ▂▃▅▆▇

Racing Stats

9 races   |
  • 1 0 1
 Best Time14.30 sec
No rank  Racing *** Pts
22.2 % wins (2) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: ATATTATCAGTACTACCACGAAACCACTACAAC
A
T
A
T
T
A
T
C
A
G
T
A
C
T
A
C
C
A
C
G
A
A
A
C
C
A
C
T
A
C
A
A
C
Genes: CF7ED59GHJG

Composition

Boxer
18%
Schnauzer
9%
Yorkshire Terrier
9%
German Shepard
9%
Shiba Inu
9%
Beagle
9%
Labrador
9%
French Bulldog
9%
Rottweiler
9%
Border Collie
9%

Current Energy

Vitality +18 points
Lunar Effect 0 points

Traits Breakdown

Body Schnauzer
Tail Yorkshire Terrier
Legs German Shepard
Front Legs Shiba Inu
Head Beagle
Ears Labrador
Snout French Bulldog
Mouth Boxer
Nose Rottweiler
Eyes Border Collie
Color Boxer