Murray Midnight Crypto Dog - Mix of Boxer, Rottweiler, Border Collie, Labrador, German Shepard, Labrador BK, Pitbull terrier and Dachshund

Achievements

Racer
Murray Midnight
Murray Midnight here. Wanna play? I am on a mission to sniff all the butts in the world. ALL the butts. Ultimate Frisbee is my favorite sport. I haven't really mastered the throwing part yet, but I have the catching part down! I'll be mostly faithful to you...if we can agree on a bootie-pass for that Taco Bell dog!
  • Purity 8%
  • Age 4 months
  • Racing Exp 16
  • Boxer 27%
  • 2 races
  • Gen 1
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 2 0 0
2 races    Best Time14.25 sec
No rank  Racing *** Coins
100.0 % wins (2) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CACAACTACCCATCAAACAACGCATCCCACGGA
C
A
C
A
A
C
T
A
C
C
C
A
T
C
A
A
A
C
A
A
C
G
C
A
T
C
C
C
A
C
G
G
A
Genes: HGJ57GG6NHA

Composition

Boxer
27%
Rottweiler
18%
Border Collie
9%
Labrador
9%
German Shepard
9%
Labrador BK
9%
Pitbull terrier
9%
Dachshund
9%

Current Energy

Vitality -6 points
Lunar Effect 0 points

Traits Breakdown

Body Rottweiler
Tail Boxer
Legs Border Collie
Front Legs Labrador
Head German Shepard
Ears Boxer
Snout Boxer
Mouth Labrador BK
Nose Pitbull terrier
Eyes Rottweiler
Color Dachshund