Calvin Corky Crypto Dog - Mix of Rottweiler, Husky, Corgi, Pitbull terrier, Golder Retriever, French Bulldog, Grey Wolf and Pug

Achievements

None
Calvin Corky
Salutations! My name's Calvin Corky. You can access my database anytime with your WiFi. I don't like it when my bowl is empty, so I take it to my human and it magically refills! I live life by my favorite quote "Every dog has it's day", but every day is my day!
  • Purity 6%
  • Age 4 months
  • Racing Exp 0
  • Rottweiler 18%
  • 0 races
  • Gen 1
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CACTCCACAAGACACAGCAGCACACGACCCGAA
C
A
C
T
C
C
A
C
A
A
G
A
C
A
C
A
G
C
A
G
C
A
C
A
C
G
A
C
C
C
G
A
A
Genes: HN48HOO49L2

Composition

Rottweiler
18%
Husky
18%
Corgi
18%
Pitbull terrier
9%
Golder Retriever
9%
French Bulldog
9%
Grey Wolf
9%
Pug
9%

Current Energy

Vitality -25 points
Lunar Effect +2 points

Traits Breakdown

Body Rottweiler
Tail Pitbull terrier
Legs Husky
Front Legs Golder Retriever
Head Rottweiler
Ears Corgi
Snout Corgi
Mouth Husky
Nose French Bulldog
Eyes Grey Wolf
Color Pug