Kiva Kong Crypto Dog - Mix of St. Bernard, Rottweiler, Grey Wolf, Corgi, German Shepard, Labrador, Shiba Inu and Pitbull terrier

Achievements

Podium Champion
Pro Racer
Master Champion
Kiva Kong
Salutations! My name's Kiva Kong. You can access my database anytime with your WiFi. I don't like it when my bowl is empty, so I take it to my human and it magically refills! I live life by my favorite quote "Every dog has it's day", but every day is my day!
  • Purity 8%
  • Age 31 days
  • Racing Exp 92
  • St. Bernard 27%
  • 15 races
  • Gen 0
Share it to make him Happy!
Sad & Slothful
Energy: ▂▃▅▆▇

Racing Stats

15 races   |
  • 7 3 2
 Best Time14.42 sec
Rank 48  Racing *** Pts
80.0 % wins (12) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CCCCACAGCTCACCATGACACTGATGAGTATCC
C
C
C
C
A
C
A
G
C
T
C
A
C
C
A
T
G
A
C
A
C
T
G
A
T
G
A
G
T
A
T
C
C
Genes: LHO75BHBBEN

Composition

St. Bernard
27%
Rottweiler
18%
Grey Wolf
9%
Corgi
9%
German Shepard
9%
Labrador
9%
Shiba Inu
9%
Pitbull terrier
9%

Current Energy

Vitality +47 points
Lunar Effect +14 points

Traits Breakdown

Body Grey Wolf
Tail Rottweiler
Legs Corgi
Front Legs German Shepard
Head Labrador
Ears St. Bernard
Snout Rottweiler
Mouth St. Bernard
Nose St. Bernard
Eyes Shiba Inu
Color Pitbull terrier

Parents

Children

Photos

online dog racing Litecoin canine race online dog racing crypto canine race podium Litecoin dog racing podium crypto pet race Litecoin pet race podium Bitcoin dog racing