Axel Abbot Bitcoin Game Dog - Mix of French Bulldog, Yorkshire Terrier, Husky, Schnauzer, Grey Wolf, Maltese, Golder Retriever, Dachshund, Pitbull terrier, Poodle and Border Collie

Achievements

None
Axel Abbot
The place I like most in the world is curled up in my human's bed, hogging all the covers! I hate having to share my food dish... I adore sleeping upside down with my tongue hanging out! I enjoy destroying a nice fresh pair of slippers.
  • Purity 0%
  • Age 4 months
  • Racing Exp 0
  • Mixed-breed
  • 0 races
  • Gen 0
Share it to make him Happy!
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CGATTAACAATACCCACCAGAGGATCCGACTAC
C
G
A
T
T
A
A
C
A
A
T
A
C
C
C
A
C
C
A
G
A
G
G
A
T
C
C
G
A
C
T
A
C
Genes: 9F4CLK8ANIJ

Composition

French Bulldog
9%
Yorkshire Terrier
9%
Husky
9%
Schnauzer
9%
Grey Wolf
9%
Maltese
9%
Golder Retriever
9%
Dachshund
9%
Pitbull terrier
9%
Poodle
9%
Border Collie
9%

Current Energy

Vitality -31 points
Lunar Effect -4 points

Traits Breakdown

Body French Bulldog
Tail Yorkshire Terrier
Legs Husky
Front Legs Schnauzer
Head Grey Wolf
Ears Maltese
Snout Golder Retriever
Mouth Dachshund
Nose Pitbull terrier
Eyes Poodle
Color Border Collie