Toots Titan Bitcoin Game Dog - Mix of Labrador, Shiba Inu, Maltese, St. Bernard, French Bulldog, Poodle, Corgi, Husky and Pitbull terrier

Achievements

Podium Champion
Pro Racer
Master Champion
Toots Titan
The place I like most in the world is curled up in my human's bed, hogging all the covers! I hate having to share my food dish... I adore sleeping upside down with my tongue hanging out! I enjoy destroying a nice fresh pair of slippers.
  • Purity 3%
  • Age 31 days
  • Racing Exp 77
  • Labrador 18%
  • 14 races
  • Gen 0
Share it to make him Happy!
Sad & Slothful
Energy: ▂▃▅▆▇

Racing Stats

14 races   |
  • 5 3 2
 Best Time14.35 sec
Rank 33  Racing *** Pts
71.4 % wins (10) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: ACCTGACGAGACCCAGTACCAAGCACAGTATCC
A
C
C
T
G
A
C
G
A
G
A
C
C
C
A
G
T
A
C
C
A
A
G
C
A
C
A
G
T
A
T
C
C
Genes: KB9I5E5O4EN

Composition

Labrador
18%
Shiba Inu
18%
Maltese
9%
St. Bernard
9%
French Bulldog
9%
Poodle
9%
Corgi
9%
Husky
9%
Pitbull terrier
9%

Current Energy

Vitality +4 points
Lunar Effect +2 points

Traits Breakdown

Body Maltese
Tail St. Bernard
Legs French Bulldog
Front Legs Poodle
Head Labrador
Ears Shiba Inu
Snout Labrador
Mouth Corgi
Nose Husky
Eyes Shiba Inu
Color Pitbull terrier

Parents

Children

Photos

virtual pet racing cryptocurrency pet race Litecoin pet race virtual canine race photo cryptocurrency pet racing photo cryptocurrency doggy race online canine race Litecoin canine racing photo