Rambo Rose Cryptocurrency Game Dog - Mix of Pug, Husky, Golder Retriever, Border Collie, Labrador, Yorkshire Terrier and French Bulldog

Achievements

None
Rambo Rose
Hey there... I'm Rambo Rose. If I can't reach it to clean it myself, it doesn't need cleaning! You know the worst? Watching my humans 'get it on' when I've got no one. My human's feet are definitely the greatest smell ever. Especially after a long day at work! I'm not that picky. Wanna mate?
  • Purity 11%
  • Age 33 days
  • Racing Exp 0
  • Pug 27%
  • 0 races
  • Gen 20
Share it to make him Happy!
Sad & Slothful
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: ACAACAAGATACCCAGAAGAAAGATTAGAACGA
A
C
A
A
C
A
A
G
A
T
A
C
C
C
A
G
A
A
G
A
A
A
G
A
T
T
A
G
A
A
C
G
A
Genes: 448J5228F29

Composition

Pug
27%
Husky
18%
Golder Retriever
18%
Border Collie
9%
Labrador
9%
Yorkshire Terrier
9%
French Bulldog
9%

Current Energy

Vitality +37 points
Lunar Effect -10 points

Traits Breakdown

Body Husky
Tail Husky
Legs Golder Retriever
Front Legs Border Collie
Head Labrador
Ears Pug
Snout Pug
Mouth Golder Retriever
Nose Yorkshire Terrier
Eyes Pug
Color French Bulldog