Elwood Ellie Litecoin Game Dog - Mix of St. Bernard, Schnauzer, Poodle, Beagle, Pitbull terrier, French Bulldog, Husky, Border Collie, Rottweiler, Dachshund and Yorkshire Terrier

Achievements

None
Elwood Ellie
I live in cyberspace. I'm going kill that damn Nyan Cat if I can catch it. My favorite place to sleep is under the covers between my humans. After introductory sniffing, I like some licking. If you are looking for a pooch who's in touch with feelings, here I am.
  • Purity 0%
  • Age 33 days
  • Racing Exp 0
  • Mixed-breed
  • 0 races
  • Gen 0
Share it to make him Happy!
Sad & Slothful
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TGAATAGACCTATCCCGAACATACCACGGATTA
T
G
A
A
T
A
G
A
C
C
T
A
T
C
C
C
G
A
A
C
A
T
A
C
C
A
C
G
G
A
T
T
A
Genes: BCIDN94JHAF

Composition

St. Bernard
9%
Schnauzer
9%
Poodle
9%
Beagle
9%
Pitbull terrier
9%
French Bulldog
9%
Husky
9%
Border Collie
9%
Rottweiler
9%
Dachshund
9%
Yorkshire Terrier
9%

Current Energy

Vitality -15 points
Lunar Effect -4 points

Traits Breakdown

Body St. Bernard
Tail Schnauzer
Legs Poodle
Front Legs Beagle
Head Pitbull terrier
Ears French Bulldog
Snout Husky
Mouth Border Collie
Nose Rottweiler
Eyes Dachshund
Color Yorkshire Terrier

Parents

No Children