Miss Priss Mercedes Digital Cryptocurrency Dog - Mix of Dachshund, Maltese, Poodle, Border Collie, Boxer, Rottweiler, St. Bernard and French Bulldog

Achievements

None
Miss Priss Mercedes
Let me introduce myself, I'm Miss Priss Mercedes. I'm having some new data architecture built for me, then I'd like to have you over to my place. I love cuddling up, doggy-style after a romantic evening. I believe running along the beach to catch a stick can be nearly orgasmic.
  • Purity 9%
  • Age 31 days
  • Racing Exp 0
  • Dachshund 27%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GACACCACCGGATACAACCACTGAGGAGGACGA
G
A
C
A
C
C
A
C
C
G
G
A
T
A
C
A
A
C
C
A
C
T
G
A
G
G
A
G
G
A
C
G
A
Genes: IKKAJGHBAA9

Composition

Dachshund
27%
Maltese
18%
Poodle
9%
Border Collie
9%
Boxer
9%
Rottweiler
9%
St. Bernard
9%
French Bulldog
9%

Current Energy

Vitality +9 points
Lunar Effect 0 points

Traits Breakdown

Body Poodle
Tail Maltese
Legs Maltese
Front Legs Dachshund
Head Border Collie
Ears Boxer
Snout Rottweiler
Mouth St. Bernard
Nose Dachshund
Eyes Dachshund
Color French Bulldog

Parents

No Children