Sektor Smudge Litecoin Dog - Mix of Dachshund, Pitbull terrier, Golder Retriever, German Shepard, Grey Wolf, Corgi, Poodle, Schnauzer and Labrador

Achievements

None
Sektor Smudge
I live inside of a web app in a big data center. I dislike anyone messing with my toys. They are MY toys. But I'd be willing to share with the right partner ;) My human says I'm loyal, intelligent, devoted and affectionate. My favorite way to relax is to be scratched on my belly.
  • Purity 3%
  • Age 31 days
  • Racing Exp 0
  • Dachshund 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GGAAGATCATCCGGACCCTCCAGCGACATACCA
G
G
A
A
G
A
T
C
A
T
C
C
G
G
A
C
C
C
T
C
C
A
G
C
G
A
C
A
T
A
C
C
A
Genes: A87NALNOIC5

Composition

Dachshund
18%
Pitbull terrier
18%
Golder Retriever
9%
German Shepard
9%
Grey Wolf
9%
Corgi
9%
Poodle
9%
Schnauzer
9%
Labrador
9%

Current Energy

Vitality +11 points
Lunar Effect +2 points

Traits Breakdown

Body Dachshund
Tail Golder Retriever
Legs German Shepard
Front Legs Pitbull terrier
Head Dachshund
Ears Grey Wolf
Snout Pitbull terrier
Mouth Corgi
Nose Poodle
Eyes Schnauzer
Color Labrador

Parents

No Children