Nestle Niko Crypto Dog - Mix of Boxer, Yorkshire Terrier, Maltese, Grey Wolf, Beagle, Labrador, Corgi, Poodle and St. Bernard

Achievements

None
Nestle Niko
Howdy! I'm Nestle Niko. Have you ever dated a digital creation before? Small yappy creatures bug me...they disturb my zen. Ultimate Frisbee is my favorite sport. I haven't really mastered the throwing part yet, but I have the catching part down! I enjoy chasing my tail around.
  • Purity 5%
  • Age 31 days
  • Racing Exp 0
  • Boxer 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: AACACCCCCCTACCAAACTTATTAAGCGACTGA
A
A
C
A
C
C
C
C
C
C
T
A
C
C
A
A
A
C
T
T
A
T
T
A
A
G
C
G
A
C
T
G
A
Genes: GKLD5GFFOIB

Composition

Boxer
18%
Yorkshire Terrier
18%
Maltese
9%
Grey Wolf
9%
Beagle
9%
Labrador
9%
Corgi
9%
Poodle
9%
St. Bernard
9%

Current Energy

Vitality +14 points
Lunar Effect -4 points

Traits Breakdown

Body Boxer
Tail Maltese
Legs Grey Wolf
Front Legs Beagle
Head Labrador
Ears Boxer
Snout Yorkshire Terrier
Mouth Yorkshire Terrier
Nose Corgi
Eyes Poodle
Color St. Bernard

Parents

No Children