Matisse Marble Bitcoin Game Dog - Mix of Rottweiler and Yorkshire Terrier

Achievements

None
Matisse Marble
I hate being left alone all day. My human says I'm loyal, intelligent, devoted and affectionate. Removing excess stuffing from pillows is my favorite hobby. I've been known to run with bad dogs. I'm ready to settle down and have puppies...what about you?
  • Purity 82%
  • Age 4 months
  • Racing Exp 0
  • Rottweiler 91%
  • 0 races
  • Gen 7
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CACCACCACCACCACCACCACCACCACCACTTA
C
A
C
C
A
C
C
A
C
C
A
C
C
A
C
C
A
C
C
A
C
C
A
C
C
A
C
C
A
C
T
T
A
Genes: HHHHHHHHHHF

Composition

Rottweiler
91%
Yorkshire Terrier
9%

Current Energy

Vitality -24 points
Lunar Effect 0 points

Traits Breakdown

Body Rottweiler
Tail Rottweiler
Legs Rottweiler
Front Legs Rottweiler
Head Rottweiler
Ears Rottweiler
Snout Rottweiler
Mouth Rottweiler
Nose Rottweiler
Eyes Rottweiler
Color Yorkshire Terrier