Lights Out Luna Bitcoin Game Dog - Mix of Labrador BK, St. Bernard, Corgi, Golder Retriever, Boxer, Rottweiler, Border Collie, Shiba Inu and Poodle

Achievements

None
Lights Out Luna
I hate being left alone all day. My human says I'm loyal, intelligent, devoted and affectionate. Removing excess stuffing from pillows is my favorite hobby. I've been known to run with bad dogs. I'm ready to settle down and have puppies...what about you?
  • Purity 3%
  • Age 33 days
  • Racing Exp 0
  • Labrador BK 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GCAAGCAGATGAAACCACTACGTAGCATGAGAC
G
C
A
A
G
C
A
G
A
T
G
A
A
A
C
C
A
C
T
A
C
G
T
A
G
C
A
T
G
A
G
A
C
Genes: 6O8BGHJE6BI

Composition

Labrador BK
18%
St. Bernard
18%
Corgi
9%
Golder Retriever
9%
Boxer
9%
Rottweiler
9%
Border Collie
9%
Shiba Inu
9%
Poodle
9%

Current Energy

Vitality +37 points
Lunar Effect -2 points

Traits Breakdown

Body Labrador BK
Tail Corgi
Legs Golder Retriever
Front Legs St. Bernard
Head Boxer
Ears Rottweiler
Snout Border Collie
Mouth Shiba Inu
Nose Labrador BK
Eyes St. Bernard
Color Poodle

Parents

No Children