Destini Dash Litecoin Dog - Mix of St. Bernard, Dachshund, Labrador, Husky, Yorkshire Terrier, Schnauzer, Rottweiler, Golder Retriever and French Bulldog

Achievements

None
Destini Dash
How goes it? I'm Destini Dash. Rolling around on the carpet after a bath is my favorite way to dry. I really dislike when my humans leave the house. Where could they possibly go that's better than my wonderful house? I just want a snuggle buddy with a nice, soft coat.
  • Purity 5%
  • Age 33 days
  • Racing Exp 0
  • St. Bernard 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CCAACATTATGATGAATACACGGAAGACGAGGA
C
C
A
A
C
A
T
T
A
T
G
A
T
G
A
A
T
A
C
A
C
G
G
A
A
G
A
C
G
A
G
G
A
Genes: 54FBBCHA89A

Composition

St. Bernard
18%
Dachshund
18%
Labrador
9%
Husky
9%
Yorkshire Terrier
9%
Schnauzer
9%
Rottweiler
9%
Golder Retriever
9%
French Bulldog
9%

Current Energy

Vitality +24 points
Lunar Effect -4 points

Traits Breakdown

Body Labrador
Tail Husky
Legs Yorkshire Terrier
Front Legs St. Bernard
Head St. Bernard
Ears Schnauzer
Snout Rottweiler
Mouth Dachshund
Nose Golder Retriever
Eyes French Bulldog
Color Dachshund

Parents

No Children