Huck Hobbit Litecoin Dog - Mix of Boxer, Grey Wolf, Shiba Inu, Border Collie, Labrador, German Shepard, Schnauzer, Pitbull terrier, Rottweiler and Yorkshire Terrier

Achievements

None
Huck Hobbit
How goes it? I'm Huck Hobbit. Rolling around on the carpet after a bath is my favorite way to dry. I really dislike when my humans leave the house. Where could they possibly go that's better than my wonderful house? I just want a snuggle buddy with a nice, soft coat.
  • Purity 3%
  • Age 4 months
  • Racing Exp 0
  • Boxer 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Happy & Fast
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CCCGTATACCCATCAAACAACATATCCCACTTA
C
C
C
G
T
A
T
A
C
C
C
A
T
C
A
A
A
C
A
A
C
A
T
A
T
C
C
C
A
C
T
T
A
Genes: LEJ57GGCNHF

Composition

Boxer
18%
Grey Wolf
9%
Shiba Inu
9%
Border Collie
9%
Labrador
9%
German Shepard
9%
Schnauzer
9%
Pitbull terrier
9%
Rottweiler
9%
Yorkshire Terrier
9%

Current Energy

Vitality +4 points
Lunar Effect 0 points

Traits Breakdown

Body Grey Wolf
Tail Shiba Inu
Legs Border Collie
Front Legs Labrador
Head German Shepard
Ears Boxer
Snout Boxer
Mouth Schnauzer
Nose Pitbull terrier
Eyes Rottweiler
Color Yorkshire Terrier