Gunther Guinevere Bitcoin Dog - Mix of Rottweiler, French Bulldog and Yorkshire Terrier

Achievements

None
Gunther Guinevere
Yo dog! Gunther Guinevere here. Small yappy creatures bug me...they disturb my zen. My human says I'm loyal, intelligent, devoted and affectionate. I never met a leg I didn't want to hump. Ultimate Frisbee is my favorite sport. I haven't really mastered the throwing part yet, but I have the catching part down!
  • Purity 67%
  • Age 4 months
  • Racing Exp 0
  • Rottweiler 82%
  • 0 races
  • Gen 6
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CACCACCACCACCACCACCACCACCACCGATTA
C
A
C
C
A
C
C
A
C
C
A
C
C
A
C
C
A
C
C
A
C
C
A
C
C
A
C
C
G
A
T
T
A
Genes: HHHHHHHHH9F

Composition

Rottweiler
82%
French Bulldog
9%
Yorkshire Terrier
9%

Current Energy

Vitality -17 points
Lunar Effect 0 points

Traits Breakdown

Body Rottweiler
Tail Rottweiler
Legs Rottweiler
Front Legs Rottweiler
Head Rottweiler
Ears Rottweiler
Snout Rottweiler
Mouth Rottweiler
Nose Rottweiler
Eyes French Bulldog
Color Yorkshire Terrier