Hudson Harley Bitcoin Dog - Mix of Labrador BK, Husky, Pug, Border Collie, Yorkshire Terrier, French Bulldog, St. Bernard, Pitbull terrier, Beagle and Poodle

Achievements

None
Hudson Harley
Yo dog! Hudson Harley here. Small yappy creatures bug me...they disturb my zen. My human says I'm loyal, intelligent, devoted and affectionate. I never met a leg I didn't want to hump. Ultimate Frisbee is my favorite sport. I haven't really mastered the throwing part yet, but I have the catching part down!
  • Purity 1%
  • Age 33 days
  • Racing Exp 0
  • Labrador BK 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: ACAGAATACTTAGCACGATGAGCATCCCTAGAC
A
C
A
G
A
A
T
A
C
T
T
A
G
C
A
C
G
A
T
G
A
G
C
A
T
C
C
C
T
A
G
A
C
Genes: 42JF69B6NDI

Composition

Labrador BK
18%
Husky
9%
Pug
9%
Border Collie
9%
Yorkshire Terrier
9%
French Bulldog
9%
St. Bernard
9%
Pitbull terrier
9%
Beagle
9%
Poodle
9%

Current Energy

Vitality +26 points
Lunar Effect -4 points

Traits Breakdown

Body Husky
Tail Pug
Legs Border Collie
Front Legs Yorkshire Terrier
Head Labrador BK
Ears French Bulldog
Snout St. Bernard
Mouth Labrador BK
Nose Pitbull terrier
Eyes Beagle
Color Poodle

Parents

No Children