Road Game Road Game Litecoin Game Dog - Mix of Husky, Rottweiler, Golder Retriever, Labrador BK, Border Collie, Beagle, French Bulldog and Yorkshire Terrier

Achievements

None
Road Game Road Game
Whatcha know, honey. Road Game Road Game here. Taking a break from chasing Nyan Cat around cyberspace. I don't understand why I like smelling butts... I'm a gourmand...my favorite dish is that dry food that makes it's own gravy! I just want to share a ball with someone, if you know what I mean...
  • Purity 8%
  • Age 4 months
  • Racing Exp 0
  • Husky 27%
  • 0 races
  • Gen 0
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACAAGAGCATACACACACCACCTAACACGATTA
A
C
A
A
G
A
G
C
A
T
A
C
A
C
A
C
A
C
C
A
C
C
T
A
A
C
A
C
G
A
T
T
A
Genes: 486J4HHD49F

Composition

Husky
27%
Rottweiler
18%
Golder Retriever
9%
Labrador BK
9%
Border Collie
9%
Beagle
9%
French Bulldog
9%
Yorkshire Terrier
9%

Current Energy

Vitality -1 points
Lunar Effect +8 points

Traits Breakdown

Body Husky
Tail Golder Retriever
Legs Labrador BK
Front Legs Border Collie
Head Husky
Ears Rottweiler
Snout Rottweiler
Mouth Beagle
Nose Husky
Eyes French Bulldog
Color Yorkshire Terrier