Phoebe Puppy Litecoin Game Dog - Mix of Husky, St. Bernard, Golder Retriever, Beagle, Border Collie, Rottweiler, Poodle and Schnauzer

Achievements

None
Phoebe Puppy
Whatcha know, honey. Phoebe Puppy here. Taking a break from chasing Nyan Cat around cyberspace. I don't understand why I like smelling butts... I'm a gourmand...my favorite dish is that dry food that makes it's own gravy! I just want to share a ball with someone, if you know what I mean...
  • Purity 4%
  • Age 31 days
  • Racing Exp 0
  • Husky 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: ACATGAAGACTATACAGATGACACACAGACATA
A
C
A
T
G
A
A
G
A
C
T
A
T
A
C
A
G
A
T
G
A
C
A
C
A
C
A
G
A
C
A
T
A
Genes: 4B8DJ8BH4IC

Composition

Husky
18%
St. Bernard
18%
Golder Retriever
18%
Beagle
9%
Border Collie
9%
Rottweiler
9%
Poodle
9%
Schnauzer
9%

Current Energy

Vitality +37 points
Lunar Effect 0 points

Traits Breakdown

Body Husky
Tail St. Bernard
Legs Golder Retriever
Front Legs Beagle
Head Border Collie
Ears Golder Retriever
Snout St. Bernard
Mouth Rottweiler
Nose Husky
Eyes Poodle
Color Schnauzer

Parents

No Children