Edgar Edie Litecoin Dog - Mix of St. Bernard, Labrador BK, Husky, Pitbull terrier, German Shepard, Dachshund, Labrador, Border Collie, Maltese and Schnauzer

Achievements

None
Edgar Edie
Even living on the internet like I do, too much kibble makes my bandwidth expand. I like it when you're frisky. If you enjoy growling through fences as much as I do, we should get together. I'm looking for a hard-working service animal who can keep up with me.
  • Purity 1%
  • Age 31 days
  • Racing Exp 0
  • St. Bernard 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GCAACATCCTCATGAGGACCATACACCTGAATA
G
C
A
A
C
A
T
C
C
T
C
A
T
G
A
G
G
A
C
C
A
T
A
C
A
C
C
T
G
A
A
T
A
Genes: 64N7BA5JKBC

Composition

St. Bernard
18%
Labrador BK
9%
Husky
9%
Pitbull terrier
9%
German Shepard
9%
Dachshund
9%
Labrador
9%
Border Collie
9%
Maltese
9%
Schnauzer
9%

Current Energy

Vitality +49 points
Lunar Effect +4 points

Traits Breakdown

Body Labrador BK
Tail Husky
Legs Pitbull terrier
Front Legs German Shepard
Head St. Bernard
Ears Dachshund
Snout Labrador
Mouth Border Collie
Nose Maltese
Eyes St. Bernard
Color Schnauzer

Parents

No Children