Charmer Cupcake Litecoin Dog - Mix of Rottweiler, Border Collie, Labrador BK, French Bulldog, Shiba Inu and Maltese

Achievements

None
Charmer Cupcake
Even living on the internet like I do, too much kibble makes my bandwidth expand. I like it when you're frisky. If you enjoy growling through fences as much as I do, we should get together. I'm looking for a hard-working service animal who can keep up with me.
  • Purity 27%
  • Age 15 months
  • Racing Exp 0
  • Rottweiler 55%
  • 0 races
  • Gen 4
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CACCACCACCACTACCACGCACGACACGTAACC
C
A
C
C
A
C
C
A
C
C
A
C
T
A
C
C
A
C
G
C
A
C
G
A
C
A
C
G
T
A
A
C
C
Genes: HHHHJH69HEK

Composition

Rottweiler
55%
Border Collie
9%
Labrador BK
9%
French Bulldog
9%
Shiba Inu
9%
Maltese
9%

Current Energy

Vitality -10 points
Lunar Effect +4 points

Traits Breakdown

Body Rottweiler
Tail Rottweiler
Legs Rottweiler
Front Legs Rottweiler
Head Border Collie
Ears Rottweiler
Snout Labrador BK
Mouth French Bulldog
Nose Rottweiler
Eyes Shiba Inu
Color Maltese