Ibuki Iris Litecoin Game Dog - Mix of Schnauzer, Beagle, Maltese, Corgi, Pug, Shiba Inu, Husky, Grey Wolf, French Bulldog, St. Bernard and Rottweiler

Achievements

None
Ibuki Iris
I'm an avid runner! Outside, inside, all over the place! I just want to run! I hate it when my humans fart and they blame me! Hound Dog by Elvis is probably the best song ever written. I cry whenever I hear an ambulance siren! I'm looking for a good Tug-O-War partner.
  • Purity 0%
  • Age 32 days
  • Racing Exp 0
  • Mixed-breed
  • 0 races
  • Gen 0
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: ATACTAACCAGCGAAGTAACACCCCGATGACAC
A
T
A
C
T
A
A
C
C
A
G
C
G
A
A
G
T
A
A
C
A
C
C
C
C
G
A
T
G
A
C
A
C
Genes: CDKO2E4L9BH

Composition

Schnauzer
9%
Beagle
9%
Maltese
9%
Corgi
9%
Pug
9%
Shiba Inu
9%
Husky
9%
Grey Wolf
9%
French Bulldog
9%
St. Bernard
9%
Rottweiler
9%

Current Energy

Vitality -1 points
Lunar Effect +4 points

Traits Breakdown

Body Schnauzer
Tail Beagle
Legs Maltese
Front Legs Corgi
Head Pug
Ears Shiba Inu
Snout Husky
Mouth Grey Wolf
Nose French Bulldog
Eyes St. Bernard
Color Rottweiler

Parents

No Children