Fizzgiggle Ferdie Cryptocurrency Dog - Mix of Labrador BK, Maltese, Dachshund, Poodle, Golder Retriever, Yorkshire Terrier, Shiba Inu, French Bulldog and German Shepard

Achievements

None
Fizzgiggle Ferdie
Hello, there. Fizzgiggle Ferdie here. My favorite way to spend playtime is a good game of frisbee. I don't like to be ignored. I'd like to help you shed your coat, baby. I'm a serial monogamist.
  • Purity 4%
  • Age 33 days
  • Racing Exp 0
  • Labrador BK 27%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GCAACCGGAGACGCAAGATTAGTAGCACGATCA
G
C
A
A
C
C
G
G
A
G
A
C
G
C
A
A
G
A
T
T
A
G
T
A
G
C
A
C
G
A
T
C
A
Genes: 6KAI68FE697

Composition

Labrador BK
27%
Maltese
9%
Dachshund
9%
Poodle
9%
Golder Retriever
9%
Yorkshire Terrier
9%
Shiba Inu
9%
French Bulldog
9%
German Shepard
9%

Current Energy

Vitality +15 points
Lunar Effect -12 points

Traits Breakdown

Body Labrador BK
Tail Maltese
Legs Dachshund
Front Legs Poodle
Head Labrador BK
Ears Golder Retriever
Snout Yorkshire Terrier
Mouth Shiba Inu
Nose Labrador BK
Eyes French Bulldog
Color German Shepard