Hallie Han Solo Crypto Game Dog - Mix of Pitbull terrier, Beagle and Boxer

Achievements

None
Hallie Han Solo
Suh...you good? Hallie Han Solo here. Someday I'm gonna breakout from inside this server. My favorite dessert is licking the last of the ice cream from the carton. No chocolate, please. I have a crush on the Grumpy cat. I'm an avid runner! Outside, inside, all over the place! I just want to run!
  • Purity 65%
  • Age 4 months
  • Racing Exp 0
  • Pitbull terrier 82%
  • 0 races
  • Gen 3
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCCTCCTCCTCCTCCTCCCTATCCTCCAACTCC
T
C
C
T
C
C
T
C
C
T
C
C
T
C
C
T
C
C
C
T
A
T
C
C
T
C
C
A
A
C
T
C
C
Genes: NNNNNNDNNGN

Composition

Pitbull terrier
82%
Beagle
9%
Boxer
9%

Current Energy

Vitality -35 points
Lunar Effect 0 points

Traits Breakdown

Body Pitbull terrier
Tail Pitbull terrier
Legs Pitbull terrier
Front Legs Pitbull terrier
Head Pitbull terrier
Ears Pitbull terrier
Snout Beagle
Mouth Pitbull terrier
Nose Pitbull terrier
Eyes Boxer
Color Pitbull terrier