Dino Dana Crypto Game Dog - Mix of Boxer, Yorkshire Terrier, Poodle, Golder Retriever, St. Bernard, Husky, Dachshund and Labrador BK

Achievements

None
Dino Dana
Suh...you good? Dino Dana here. Someday I'm gonna breakout from inside this server. My favorite dessert is licking the last of the ice cream from the carton. No chocolate, please. I have a crush on the Grumpy cat. I'm an avid runner! Outside, inside, all over the place! I just want to run!
  • Purity 9%
  • Age 33 days
  • Racing Exp 0
  • Boxer 27%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: AACGACAGATGAAACAACACATTATTAGGAGCA
A
A
C
G
A
C
A
G
A
T
G
A
A
A
C
A
A
C
A
C
A
T
T
A
T
T
A
G
G
A
G
C
A
Genes: GI8BGG4FFA6

Composition

Boxer
27%
Yorkshire Terrier
18%
Poodle
9%
Golder Retriever
9%
St. Bernard
9%
Husky
9%
Dachshund
9%
Labrador BK
9%

Current Energy

Vitality +11 points
Lunar Effect -8 points

Traits Breakdown

Body Boxer
Tail Poodle
Legs Golder Retriever
Front Legs St. Bernard
Head Boxer
Ears Boxer
Snout Husky
Mouth Yorkshire Terrier
Nose Yorkshire Terrier
Eyes Dachshund
Color Labrador BK

Parents

No Children