Basil Bogey Bitcoin Dog - Mix of Poodle, German Shepard, Corgi, Pug, St. Bernard, Boxer, Schnauzer and Golder Retriever

Achievements

None
Basil Bogey
Fences are just challenges...I don't let them stop me! My favorite sport is catching treats my human throws! As a perfectionist, I have to find just the right 'spot'. I don't like having to stay off the furniture.
  • Purity 8%
  • Age 34 days
  • Racing Exp 0
  • Poodle 27%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TCAAGCGAATCAGACGACTGAAACATAGACAGA
T
C
A
A
G
C
G
A
A
T
C
A
G
A
C
G
A
C
T
G
A
A
A
C
A
T
A
G
A
C
A
G
A
Genes: 7O27IIBGCI8

Composition

Poodle
27%
German Shepard
18%
Corgi
9%
Pug
9%
St. Bernard
9%
Boxer
9%
Schnauzer
9%
Golder Retriever
9%

Current Energy

Vitality +18 points
Lunar Effect -4 points

Traits Breakdown

Body German Shepard
Tail Corgi
Legs Pug
Front Legs German Shepard
Head Poodle
Ears Poodle
Snout St. Bernard
Mouth Boxer
Nose Schnauzer
Eyes Poodle
Color Golder Retriever