Hammer Hannah Bitcoin Dog - Mix of Yorkshire Terrier, Pug, Boxer, Labrador, Shiba Inu, Corgi, Rottweiler, Poodle, Beagle, St. Bernard and French Bulldog

Achievements

None
Hammer Hannah
Fences are just challenges...I don't let them stop me! My favorite sport is catching treats my human throws! As a perfectionist, I have to find just the right 'spot'. I don't like having to stay off the furniture.
  • Purity 0%
  • Age 4 months
  • Racing Exp 0
  • Mixed-breed
  • 0 races
  • Gen 0
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TTAGAAAACCCAGTAAGCCACGACCTATGACGA
T
T
A
G
A
A
A
A
C
C
C
A
G
T
A
A
G
C
C
A
C
G
A
C
C
T
A
T
G
A
C
G
A
Genes: F2G5EOHIDB9

Composition

Yorkshire Terrier
9%
Pug
9%
Boxer
9%
Labrador
9%
Shiba Inu
9%
Corgi
9%
Rottweiler
9%
Poodle
9%
Beagle
9%
St. Bernard
9%
French Bulldog
9%

Current Energy

Vitality -26 points
Lunar Effect -4 points

Traits Breakdown

Body Yorkshire Terrier
Tail Pug
Legs Boxer
Front Legs Labrador
Head Shiba Inu
Ears Corgi
Snout Rottweiler
Mouth Poodle
Nose Beagle
Eyes St. Bernard
Color French Bulldog