Chelsea Chip Crypto Dog - Mix of Poodle, Pitbull terrier, Labrador, Yorkshire Terrier, German Shepard, St. Bernard, Labrador BK, Corgi and Husky

Achievements

None
Chelsea Chip
Hi! My name is Chelsea Chip. I adore sleeping upside down with my tongue hanging out! I'm not usually indecisive. But a new bone, a new slipper...so hard to decide! I hate it when my humans fart and they blame me! I like shaking my fur next to humans right after a good swim!
  • Purity 5%
  • Age 33 days
  • Racing Exp 0
  • Poodle 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GACCCATTATCATGAGCAGACTCCTCCAGCACA
G
A
C
C
C
A
T
T
A
T
C
A
T
G
A
G
C
A
G
A
C
T
C
C
T
C
C
A
G
C
A
C
A
Genes: I5F7B6INNO4

Composition

Poodle
18%
Pitbull terrier
18%
Labrador
9%
Yorkshire Terrier
9%
German Shepard
9%
St. Bernard
9%
Labrador BK
9%
Corgi
9%
Husky
9%

Current Energy

Vitality +25 points
Lunar Effect -2 points

Traits Breakdown

Body Poodle
Tail Labrador
Legs Yorkshire Terrier
Front Legs German Shepard
Head St. Bernard
Ears Labrador BK
Snout Poodle
Mouth Pitbull terrier
Nose Pitbull terrier
Eyes Corgi
Color Husky

Parents

No Children