Lollipop Loretta Crypto Dog - Mix of Pitbull terrier, Boxer, Corgi and Grey Wolf

Achievements

None
Lollipop Loretta
Hi! My name is Lollipop Loretta. I adore sleeping upside down with my tongue hanging out! I'm not usually indecisive. But a new bone, a new slipper...so hard to decide! I hate it when my humans fart and they blame me! I like shaking my fur next to humans right after a good swim!
  • Purity 37%
  • Age 4 months
  • Racing Exp 0
  • Pitbull terrier 64%
  • 0 races
  • Gen 2
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCCAACTCCTCCAGCTCCCCCTCCTCCAACTCC
T
C
C
A
A
C
T
C
C
T
C
C
A
G
C
T
C
C
C
C
C
T
C
C
T
C
C
A
A
C
T
C
C
Genes: NGNNONLNNGN

Composition

Pitbull terrier
64%
Boxer
18%
Corgi
9%
Grey Wolf
9%

Current Energy

Vitality -41 points
Lunar Effect -4 points

Traits Breakdown

Body Pitbull terrier
Tail Boxer
Legs Pitbull terrier
Front Legs Pitbull terrier
Head Corgi
Ears Pitbull terrier
Snout Grey Wolf
Mouth Pitbull terrier
Nose Pitbull terrier
Eyes Boxer
Color Pitbull terrier