Dallas Donald Crypto Dog - Mix of Yorkshire Terrier, Husky, St. Bernard, Shiba Inu, Border Collie, Corgi, Labrador BK, Dachshund, German Shepard and Schnauzer

Achievements

None
Dallas Donald
Baby, I'm made from the same stuff as dreams. Hope you like the smell of wet fur, because I'll jump into any water I see! Why humans throw perfectly good things away is beyond me. I'm into recycling trash bin contents. I love to find stinky things and roll in them. The stinkier, the better. Roadkill is my favorite!
  • Purity 1%
  • Age 25 days
  • Racing Exp 0
  • Yorkshire Terrier 18%
  • 0 races
  • Gen 2
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACATTATGAGTATACTTAAGCGCAGGATCAATA
A
C
A
T
T
A
T
G
A
G
T
A
T
A
C
T
T
A
A
G
C
G
C
A
G
G
A
T
C
A
A
T
A
Genes: 4FBEJFO6A7C

Composition

Yorkshire Terrier
18%
Husky
9%
St. Bernard
9%
Shiba Inu
9%
Border Collie
9%
Corgi
9%
Labrador BK
9%
Dachshund
9%
German Shepard
9%
Schnauzer
9%

Current Energy

Vitality +30 points
Lunar Effect 0 points

Traits Breakdown

Body Husky
Tail Yorkshire Terrier
Legs St. Bernard
Front Legs Shiba Inu
Head Border Collie
Ears Yorkshire Terrier
Snout Corgi
Mouth Labrador BK
Nose Dachshund
Eyes German Shepard
Color Schnauzer

Parents

No Children