Kujo Khaleesi Cryptocurrency Game Dog - Mix of Yorkshire Terrier, Corgi, Labrador, Husky, St. Bernard, Border Collie and Beagle

Achievements

None
Kujo Khaleesi
My favorite treat is to steal the pepperoni off of pizza. I'm terrified of the big, loud, metal creature with people inside that picks up the trash every week. It's really scary! I need to find someone tuff to help me protect our pups from that scheming mailman!
  • Purity 11%
  • Age 25 days
  • Racing Exp 0
  • Yorkshire Terrier 27%
  • 0 races
  • Gen 1
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACATTATGAAGCTTATTAAGCTACCCACCACTA
A
C
A
T
T
A
T
G
A
A
G
C
T
T
A
T
T
A
A
G
C
T
A
C
C
C
A
C
C
A
C
T
A
Genes: 4FBOFFOJ55D

Composition

Yorkshire Terrier
27%
Corgi
18%
Labrador
18%
Husky
9%
St. Bernard
9%
Border Collie
9%
Beagle
9%

Current Energy

Vitality +20 points
Lunar Effect -6 points

Traits Breakdown

Body Husky
Tail Yorkshire Terrier
Legs St. Bernard
Front Legs Corgi
Head Yorkshire Terrier
Ears Yorkshire Terrier
Snout Corgi
Mouth Border Collie
Nose Labrador
Eyes Labrador
Color Beagle

Parents

No Children