Hoss Hans Bitcoin Dog - Mix of Boxer, Poodle, Shiba Inu, Schnauzer, St. Bernard, Beagle, Pitbull terrier, Rottweiler and Pug

Achievements

None
Hoss Hans
I hate having to share my food dish... I'm into leather...if I have the right partner. I like exploring off leash best. My favorite game is Fetch except I never bring the ball back.
  • Purity 6%
  • Age 2 months
  • Racing Exp 0
  • Boxer 27%
  • 0 races
  • Gen 1
Make him happy share it to your friend*
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GACGTAATATGACTAAACAACTCCAACCACGAA
G
A
C
G
T
A
A
T
A
T
G
A
C
T
A
A
A
C
A
A
C
T
C
C
A
A
C
C
A
C
G
A
A
Genes: IECBDGGNGH2

Composition

Boxer
27%
Poodle
9%
Shiba Inu
9%
Schnauzer
9%
St. Bernard
9%
Beagle
9%
Pitbull terrier
9%
Rottweiler
9%
Pug
9%

Current Energy

Vitality -22 points
Lunar Effect -12 points

Traits Breakdown

Body Poodle
Tail Shiba Inu
Legs Schnauzer
Front Legs St. Bernard
Head Beagle
Ears Boxer
Snout Boxer
Mouth Pitbull terrier
Nose Boxer
Eyes Rottweiler
Color Pug

Parents

No Children