Dee Dee Dillon Digital Cryptocurrency Dog - Mix of Poodle, Labrador, Boxer, Maltese, Shiba Inu, Corgi and St. Bernard

Achievements

None
Dee Dee Dillon
Size matters. This dawg's into big databases. Man, I hate it when my humans run out of my favorite food so all I get is 'dry' stuff. My favorite movie is Dog Day Afternoon. I've never seen it but I like the title! I love licking faces! Little humans are my favorite because they usually have some good food smeared all over them!
  • Purity 9%
  • Age 27 days
  • Racing Exp 0
  • Poodle 27%
  • 0 races
  • Gen 2
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CCAGACCCAACCGTAGACAGCGACAACAACTGA
C
C
A
G
A
C
C
C
A
A
C
C
G
T
A
G
A
C
A
G
C
G
A
C
A
A
C
A
A
C
T
G
A
Genes: 5I5KEIOIGGB

Composition

Poodle
27%
Labrador
18%
Boxer
18%
Maltese
9%
Shiba Inu
9%
Corgi
9%
St. Bernard
9%

Current Energy

Vitality +31 points
Lunar Effect -8 points

Traits Breakdown

Body Labrador
Tail Poodle
Legs Labrador
Front Legs Maltese
Head Shiba Inu
Ears Poodle
Snout Corgi
Mouth Poodle
Nose Boxer
Eyes Boxer
Color St. Bernard

Parents

No Children