Holden Halfback Cryptocurrency Dog - Mix of Maltese, Golder Retriever, Labrador, French Bulldog, Schnauzer, Corgi, Yorkshire Terrier and St. Bernard

Achievements

None
Holden Halfback
Nyan Cat is my best friend here in the cyberspace. Ever play 'catch' with two humans then it turns into 'keep away'? Hate that. I've been looking for love in all the wrong places... I am looking for dogs I can run around town with...not looking for exclusivity.
  • Purity 6%
  • Age 29 days
  • Racing Exp 0
  • Maltese 27%
  • 0 races
  • Gen 1
Share it to make him Happy!
Sad & Tardy
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACCCCAAGAACCCGAATAAGCAGAACCTTATGA
A
C
C
C
C
A
A
G
A
A
C
C
C
G
A
A
T
A
A
G
C
A
G
A
A
C
C
T
T
A
T
G
A
Genes: K58K9CO8KFB

Composition

Maltese
27%
Golder Retriever
18%
Labrador
9%
French Bulldog
9%
Schnauzer
9%
Corgi
9%
Yorkshire Terrier
9%
St. Bernard
9%

Current Energy

Vitality -2 points
Lunar Effect -4 points

Traits Breakdown

Body Maltese
Tail Labrador
Legs Golder Retriever
Front Legs Maltese
Head French Bulldog
Ears Schnauzer
Snout Corgi
Mouth Golder Retriever
Nose Maltese
Eyes Yorkshire Terrier
Color St. Bernard