Juri Jeannie Litecoin Dog - Mix of Grey Wolf, Labrador, French Bulldog, Beagle, Yorkshire Terrier, Corgi and Labrador BK

Achievements

None
Juri Jeannie
How do you do? I'm Juri Jeannie. I run with a pack in the data warehouse. I'll eat my vomit and yours too. Hope you like the smell of wet fur, because I'll jump into any water I see! I hate the mailman! He's always trying to sneak up on me, but I've got my eye on him!
  • Purity 7%
  • Age 2 months
  • Racing Exp 0
  • Grey Wolf 27%
  • 0 races
  • Gen 2
Make him happy share it to your friend*
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CCCCTATTACCACCCAGCCCACGAGCACCCCGA
C
C
C
C
T
A
T
T
A
C
C
A
C
C
C
A
G
C
C
C
A
C
G
A
G
C
A
C
C
C
C
G
A
Genes: LDF5LO596L9

Composition

Grey Wolf
27%
Labrador
18%
French Bulldog
18%
Beagle
9%
Yorkshire Terrier
9%
Corgi
9%
Labrador BK
9%

Current Energy

Vitality -11 points
Lunar Effect -6 points

Traits Breakdown

Body Grey Wolf
Tail Beagle
Legs Yorkshire Terrier
Front Legs Labrador
Head Grey Wolf
Ears Corgi
Snout Labrador
Mouth French Bulldog
Nose Labrador BK
Eyes Grey Wolf
Color French Bulldog