Dusty Daffy Cryptocurrency Dog - Mix of Schnauzer, Rottweiler, Maltese, Pug, Yorkshire Terrier, Border Collie, Beagle and French Bulldog

Achievements

None
Dusty Daffy
Nice to meet you! I'm Dusty Daffy. I work hard all day as a data miner on the web, and that pawsitively irritating Nyan Cat doesn't work at all. You may prefer walking, but hey, if a human wants to carry me, I'll let 'em. I 'm here for something RUFF ;)
  • Purity 8%
  • Age 2 months
  • Racing Exp 0
  • Schnauzer 27%
  • 0 races
  • Gen 1
Make him happy share it to your friend*
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACCATAATACACGAATTACACTACCTACGAATA
A
C
C
A
T
A
A
T
A
C
A
C
G
A
A
T
T
A
C
A
C
T
A
C
C
T
A
C
G
A
A
T
A
Genes: KCCH2FHJD9C

Composition

Schnauzer
27%
Rottweiler
18%
Maltese
9%
Pug
9%
Yorkshire Terrier
9%
Border Collie
9%
Beagle
9%
French Bulldog
9%

Current Energy

Vitality -26 points
Lunar Effect -12 points

Traits Breakdown

Body Maltese
Tail Schnauzer
Legs Schnauzer
Front Legs Rottweiler
Head Pug
Ears Yorkshire Terrier
Snout Rottweiler
Mouth Border Collie
Nose Beagle
Eyes French Bulldog
Color Schnauzer