Mystique Mercy Litecoin Dog - Mix of Grey Wolf, Rottweiler, Golder Retriever, Pitbull terrier, Labrador BK, German Shepard and Labrador

Achievements

None
Mystique Mercy
Howdy potential partner! Mystique Mercy here. My favorite place in the world is the dog park. So many smells! I slept with a cat and I liked it. I hate the mailman! He's always trying to sneak up on me, but I've got my eye on him! It's okay with me just to touch paws while we watch t.v. on the couch if you want to start slow.
  • Purity 11%
  • Age 2 months
  • Racing Exp 0
  • Grey Wolf 27%
  • 0 races
  • Gen 2
Make him happy share it to your friend*
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: CCCTCCCACGCATCACCCCCCCACAGAAGACCA
C
C
C
T
C
C
C
A
C
G
C
A
T
C
A
C
C
C
C
C
C
C
A
C
A
G
A
A
G
A
C
C
A
Genes: LNH67LLH885

Composition

Grey Wolf
27%
Rottweiler
18%
Golder Retriever
18%
Pitbull terrier
9%
Labrador BK
9%
German Shepard
9%
Labrador
9%

Current Energy

Vitality -1 points
Lunar Effect -2 points

Traits Breakdown

Body Grey Wolf
Tail Pitbull terrier
Legs Rottweiler
Front Legs Labrador BK
Head German Shepard
Ears Grey Wolf
Snout Grey Wolf
Mouth Rottweiler
Nose Golder Retriever
Eyes Golder Retriever
Color Labrador