Kelly Keanu Bitcoin Dog - Mix of Shiba Inu, Boxer, Corgi, Grey Wolf, Maltese, Golder Retriever, Pitbull terrier, Rottweiler, Pug and Yorkshire Terrier

Achievements

None
Kelly Keanu
I may need de-worming. I could spend days on end chasing my tail. I get so close but it's just so fast! I dislike anyone messing with my toys. They are MY toys. But I'd be willing to share with the right partner ;) It's okay with me just to touch paws while we watch t.v. on the couch if you want to start slow.
  • Purity 1%
  • Age 2 months
  • Racing Exp 0
  • Shiba Inu 18%
  • 0 races
  • Gen 1
Make him happy share it to your friend*
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AACAGCGTACCCACCAGATCCCACGAATTAGTA
A
A
C
A
G
C
G
T
A
C
C
C
A
C
C
A
G
A
T
C
C
C
A
C
G
A
A
T
T
A
G
T
A
Genes: GOELK8NH2FE

Composition

Shiba Inu
18%
Boxer
9%
Corgi
9%
Grey Wolf
9%
Maltese
9%
Golder Retriever
9%
Pitbull terrier
9%
Rottweiler
9%
Pug
9%
Yorkshire Terrier
9%

Current Energy

Vitality -5 points
Lunar Effect 0 points

Traits Breakdown

Body Boxer
Tail Corgi
Legs Shiba Inu
Front Legs Grey Wolf
Head Maltese
Ears Golder Retriever
Snout Pitbull terrier
Mouth Rottweiler
Nose Pug
Eyes Yorkshire Terrier
Color Shiba Inu

Parents

No Children