Nell Niko Litecoin Dog - Mix of German Shepard, Pitbull terrier, Rottweiler, Golder Retriever, Dachshund, Schnauzer and Border Collie

Achievements

None
Nell Niko
I'd like to take you for a byte to eat in cyberspace. I like it when you're frisky. I wish my human wouldn't get mad at me for going through the trash. They were obviously finished with it, why can't I have it?! Hound Dog by Elvis is probably the best song ever written.
  • Purity 7%
  • Age 34 days
  • Racing Exp 0
  • German Shepard 27%
  • 0 races
  • Gen 4
Share it to make him Happy!
Sad & Slothful
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCATCCCACAGATCCTCAGGACACATATCATAC
T
C
A
T
C
C
C
A
C
A
G
A
T
C
C
T
C
A
G
G
A
C
A
C
A
T
A
T
C
A
T
A
C
Genes: 7NH8N7AHC7J

Composition

German Shepard
27%
Pitbull terrier
18%
Rottweiler
18%
Golder Retriever
9%
Dachshund
9%
Schnauzer
9%
Border Collie
9%

Current Energy

Vitality +17 points
Lunar Effect +12 points

Traits Breakdown

Body German Shepard
Tail Pitbull terrier
Legs Rottweiler
Front Legs Golder Retriever
Head Pitbull terrier
Ears German Shepard
Snout Dachshund
Mouth Rottweiler
Nose Schnauzer
Eyes German Shepard
Color Border Collie

Parents

No Children