Jimmy Chew Judy Cryptocurrency Game Dog - Mix of German Shepard, Boxer, Rottweiler, Pug, Grey Wolf and Corgi

Achievements

None
Jimmy Chew Judy
Hey dawg! I'm Jimmy Chew Judy. My favorite thing is to sit in my humans' laps while they are trying to read or drive. I slept with a cat and I liked it. I don't like to be ignored. I really enjoy squeaky toys! Well, I like ripping them apart and taking out the squeaker!
  • Purity 9%
  • Age 8 months
  • Racing Exp 0
  • German Shepard 27%
  • 0 races
  • Gen 1
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AACTCACCCTCAAACCACGAAAGCCACGAATCA
A
A
C
T
C
A
C
C
C
T
C
A
A
A
C
C
A
C
G
A
A
A
G
C
C
A
C
G
A
A
T
C
A
Genes: G7L7GH2OH27

Composition

German Shepard
27%
Boxer
18%
Rottweiler
18%
Pug
18%
Grey Wolf
9%
Corgi
9%

Current Energy

Vitality -17 points
Lunar Effect +2 points

Traits Breakdown

Body Boxer
Tail German Shepard
Legs Grey Wolf
Front Legs German Shepard
Head Boxer
Ears Rottweiler
Snout Pug
Mouth Corgi
Nose Rottweiler
Eyes Pug
Color German Shepard