Woofie Waddles Crypto Game Dog - Mix of German Shepard, Pug, Labrador BK, Border Collie, Yorkshire Terrier, Rottweiler, Boxer, Maltese and Schnauzer

Achievements

None
Woofie Waddles
As a good digital dog, my humans give me virtually everything. I don't appreciate being around bores who bark too much. I enjoy staying active, and running circles around puppies and young children. I'm looking for mate whose willing to clean my ears and forehead after I dumpster dive.
  • Purity 8%
  • Age 36 days
  • Racing Exp 0
  • German Shepard 27%
  • 0 races
  • Gen 1
Share it to make him Happy!
Sad & Slothful
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCAGAAGCATACTTACACAACACCATATCATCA
T
C
A
G
A
A
G
C
A
T
A
C
T
T
A
C
A
C
A
A
C
A
C
C
A
T
A
T
C
A
T
C
A
Genes: 726JFHGKC77

Composition

German Shepard
27%
Pug
9%
Labrador BK
9%
Border Collie
9%
Yorkshire Terrier
9%
Rottweiler
9%
Boxer
9%
Maltese
9%
Schnauzer
9%

Current Energy

Vitality +40 points
Lunar Effect 0 points

Traits Breakdown

Body German Shepard
Tail Pug
Legs Labrador BK
Front Legs Border Collie
Head Yorkshire Terrier
Ears Rottweiler
Snout Boxer
Mouth Maltese
Nose Schnauzer
Eyes German Shepard
Color German Shepard