Gus Google Litecoin Dog - Mix of Boxer, Husky, Dachshund, Labrador, Golder Retriever, Maltese, Pug and German Shepard

Achievements

None
Gus Google
Gus Google is the name, love is my game. And fetch of course... I've been looking for love in all the wrong places... I'm always up for a nice long walk around the neighborhood. You may prefer walking, but hey, if a human wants to carry me, I'll let 'em.
  • Purity 9%
  • Age 8 months
  • Racing Exp 0
  • Boxer 27%
  • 0 races
  • Gen 2
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AACAACGGACCAAACAGAACAACAACCGAATCA
A
A
C
A
A
C
G
G
A
C
C
A
A
A
C
A
G
A
A
C
A
A
C
A
A
C
C
G
A
A
T
C
A
Genes: GGA5G844K27

Composition

Boxer
27%
Husky
18%
Dachshund
9%
Labrador
9%
Golder Retriever
9%
Maltese
9%
Pug
9%
German Shepard
9%

Current Energy

Vitality -38 points
Lunar Effect 0 points

Traits Breakdown

Body Boxer
Tail Boxer
Legs Dachshund
Front Legs Labrador
Head Boxer
Ears Golder Retriever
Snout Husky
Mouth Husky
Nose Maltese
Eyes Pug
Color German Shepard