Lilo Liberty Crypto Dog - Mix of German Shepard, Pug, Grey Wolf, Border Collie, Shiba Inu, Dachshund and St. Bernard

Achievements

None
Lilo Liberty
I absolutely love long walks when I can stop and smell the bushes. I really enjoy heavy petting. I've had my nose rubbed in 'it' more than once. I dislike anyone messing with my toys. They are MY toys. But I'd be willing to share with the right partner ;) Just looking to sow some wild oats here...
  • Purity 9%
  • Age 42 days
  • Racing Exp 0
  • German Shepard 18%
  • 0 races
  • Gen 1
Share it to make him Happy!
Sad & Slothful
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCAGAACCCCCCTCAGTAGGAGAATGATACTAC
T
C
A
G
A
A
C
C
C
C
C
C
T
C
A
G
T
A
G
G
A
G
A
A
T
G
A
T
A
C
T
A
C
Genes: 72LL7EA2BJJ

Composition

German Shepard
18%
Pug
18%
Grey Wolf
18%
Border Collie
18%
Shiba Inu
9%
Dachshund
9%
St. Bernard
9%

Current Energy

Vitality +64 points
Lunar Effect +4 points

Traits Breakdown

Body German Shepard
Tail Pug
Legs Grey Wolf
Front Legs Grey Wolf
Head German Shepard
Ears Shiba Inu
Snout Dachshund
Mouth Pug
Nose St. Bernard
Eyes Border Collie
Color Border Collie