Cricket Codex Litecoin Dog - Mix of German Shepard, Pug, Labrador BK, Grey Wolf, Yorkshire Terrier, Border Collie, Boxer, Schnauzer and French Bulldog

Achievements

None
Cricket Codex
Hi, I'm Cricket Codex. I like never worrying about my dog poo. I've got people for that. Hound Dog by Elvis is probably the best song ever written. My 'G' spot is under my chin...scratch me there and I'll growl softly. New experiences? New treats? New places! Yes, please!
  • Purity 4%
  • Age 43 days
  • Racing Exp 0
  • German Shepard 27%
  • 0 races
  • Gen 1
Share it to make him Happy!
Sad & Slothful
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCAGAAGCACCCTTATACAACTCAATATCACGA
T
C
A
G
A
A
G
C
A
C
C
C
T
T
A
T
A
C
A
A
C
T
C
A
A
T
A
T
C
A
C
G
A
Genes: 726LFJG7C79

Composition

German Shepard
27%
Pug
9%
Labrador BK
9%
Grey Wolf
9%
Yorkshire Terrier
9%
Border Collie
9%
Boxer
9%
Schnauzer
9%
French Bulldog
9%

Current Energy

Vitality +31 points
Lunar Effect 0 points

Traits Breakdown

Body German Shepard
Tail Pug
Legs Labrador BK
Front Legs Grey Wolf
Head Yorkshire Terrier
Ears Border Collie
Snout Boxer
Mouth German Shepard
Nose Schnauzer
Eyes German Shepard
Color French Bulldog

Parents

No Children