Stewie Salty Bitcoin Dog - Mix of Golder Retriever, French Bulldog, Border Collie, Rottweiler, St. Bernard, Pug and Shiba Inu

Achievements

None
Stewie Salty
I'm not a bad dog, my data is just configured that way. My favorite thing to do is go to the pet store with my human. All the other humans pet me and I get to pick out a new toy! I love fetching anything my human throws! Looking for that special tail wag.
  • Purity 12%
  • Age 45 days
  • Racing Exp 0
  • Golder Retriever 36%
  • 0 races
  • Gen 3
Share it to make him Happy!
Sad & Slothful
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AGACGATACAGACACTGAAGAGAACGAGTAAGA
A
G
A
C
G
A
T
A
C
A
G
A
C
A
C
T
G
A
A
G
A
G
A
A
C
G
A
G
T
A
A
G
A
Genes: 89J8HB829E8

Composition

Golder Retriever
36%
French Bulldog
18%
Border Collie
9%
Rottweiler
9%
St. Bernard
9%
Pug
9%
Shiba Inu
9%

Current Energy

Vitality +46 points
Lunar Effect +4 points

Traits Breakdown

Body Golder Retriever
Tail French Bulldog
Legs Border Collie
Front Legs Golder Retriever
Head Rottweiler
Ears St. Bernard
Snout Golder Retriever
Mouth Pug
Nose French Bulldog
Eyes Shiba Inu
Color Golder Retriever