Agent 47 Aspirin Litecoin Dog - Mix of Dachshund, Poodle, Border Collie, Yorkshire Terrier, Husky, Corgi, Maltese and Golder Retriever

Achievements

None
Agent 47 Aspirin
I have an ongoing battle with the vacuum cleaner. It's loud and it steals all the food crumbs I was saving for later! Creativity is my middle name... I turn everything in to a chew toy. I'm into leather...if I have the right partner. Walks on the beach are nice, but my favorite thing in the world is go shopping to PetCo for a new bone.
  • Purity 4%
  • Age 53 days
  • Racing Exp 0
  • Dachshund 18%
  • 0 races
  • Gen 1
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TTAGGAGACGGAACATACAGCACCGACTACAGA
T
T
A
G
G
A
G
A
C
G
G
A
A
C
A
T
A
C
A
G
C
A
C
C
G
A
C
T
A
C
A
G
A
Genes: FAIA4JOKIJ8

Composition

Dachshund
18%
Poodle
18%
Border Collie
18%
Yorkshire Terrier
9%
Husky
9%
Corgi
9%
Maltese
9%
Golder Retriever
9%

Current Energy

Vitality +4 points
Lunar Effect -10 points

Traits Breakdown

Body Yorkshire Terrier
Tail Dachshund
Legs Poodle
Front Legs Dachshund
Head Husky
Ears Border Collie
Snout Corgi
Mouth Maltese
Nose Poodle
Eyes Border Collie
Color Golder Retriever

Parents

No Children