Cyrano Christie Virtual Crypto Game Dog - Mix of Boxer, Rottweiler, French Bulldog, Dachshund, Corgi and Pug

Achievements

None
Cyrano Christie
Hello, there. Cyrano Christie here. Someday I'm gonna breakout from inside this server. Size doesn't matter, I like 'em all. I love it when you show a little teeth. I get really sad when I finish a bone, but my human has a magic power to just make new ones appear! Where are they coming from?? I want to find someone I can wrestle with and nibble on. Does that sound like you?
  • Purity 12%
  • Age 3 months
  • Racing Exp 0
  • Boxer 27%
  • 0 races
  • Gen 1
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AACCGAGGAAACAACCACCGAAGCCACGAACAC
A
A
C
C
G
A
G
G
A
A
A
C
A
A
C
C
A
C
C
G
A
A
G
C
C
A
C
G
A
A
C
A
C
Genes: G9AGGH9OH2H

Composition

Boxer
27%
Rottweiler
27%
French Bulldog
18%
Dachshund
9%
Corgi
9%
Pug
9%

Current Energy

Vitality -23 points
Lunar Effect +10 points

Traits Breakdown

Body Boxer
Tail French Bulldog
Legs Dachshund
Front Legs Boxer
Head Boxer
Ears Rottweiler
Snout French Bulldog
Mouth Corgi
Nose Rottweiler
Eyes Pug
Color Rottweiler