Tobie Token Cryptocurrency Dog - Mix of German Shepard, Boxer, Husky, Rottweiler, Yorkshire Terrier, Corgi and Poodle

Achievements

None
Tobie Token
Hi, Tobie Token is my name. Hound Dog by Elvis is probably the best song ever written. I never met a crotch or a butt I didn't like, but I'm just friendly that way. Watching kids play without me is the worst, no? I'm looking to share time together and not just to be an accessory.
  • Purity 9%
  • Age 3 months
  • Racing Exp 0
  • German Shepard 27%
  • 0 races
  • Gen 7
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AACTCACACTTAAACTCAACAACAAGCGACTCA
A
A
C
T
C
A
C
A
C
T
T
A
A
A
C
T
C
A
A
C
A
A
C
A
A
G
C
G
A
C
T
C
A
Genes: G7HFG744OI7

Composition

German Shepard
27%
Boxer
18%
Husky
18%
Rottweiler
9%
Yorkshire Terrier
9%
Corgi
9%
Poodle
9%

Current Energy

Vitality -32 points
Lunar Effect -4 points

Traits Breakdown

Body Boxer
Tail German Shepard
Legs Rottweiler
Front Legs Yorkshire Terrier
Head Boxer
Ears German Shepard
Snout Husky
Mouth Husky
Nose Corgi
Eyes Poodle
Color German Shepard