Mackenzie Marble Digital Cryptocurrency Game Dog - Mix of Shiba Inu, Beagle, Maltese, Boxer, Husky, Rottweiler and Border Collie

Achievements

None
Mackenzie Marble
I live in your digital dreams. You know the worst? Watching my humans 'get it on' and I have to lick myself. I am a proud show dog. I like showing off my perfect coat! My humans say I bark too much, but I have a lot to say! My favorite movie is Dog Day Afternoon. I've never seen it but I like the title!
  • Purity 12%
  • Age 3 months
  • Racing Exp 0
  • Shiba Inu 36%
  • 0 races
  • Gen 1
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GTAACCGTAGTAAACCTAACACTAGTACACTAC
G
T
A
A
C
C
G
T
A
G
T
A
A
A
C
C
T
A
A
C
A
C
T
A
G
T
A
C
A
C
T
A
C
Genes: EKEEGD4DEHJ

Composition

Shiba Inu
36%
Beagle
18%
Maltese
9%
Boxer
9%
Husky
9%
Rottweiler
9%
Border Collie
9%

Current Energy

Vitality -31 points
Lunar Effect -10 points

Traits Breakdown

Body Shiba Inu
Tail Maltese
Legs Shiba Inu
Front Legs Shiba Inu
Head Boxer
Ears Beagle
Snout Husky
Mouth Beagle
Nose Shiba Inu
Eyes Rottweiler
Color Border Collie

Parents

No Children