Zonuts Zinger Litecoin Dog - Mix of Yorkshire Terrier, French Bulldog, Husky, Shiba Inu, Labrador, Border Collie, Labrador BK and Rottweiler

Achievements

None
Zonuts Zinger
A-yo...Call me Zonuts Zinger. I really enjoy heavy petting. My human's feet are definitely the greatest smell ever. Especially after a long day at work! Halloween costumes are the worst, I hate 'em! I'm trying to find a dog who'll let me stick my nose where I want, whenever I want.
  • Purity 8%
  • Age 3 months
  • Racing Exp 0
  • Yorkshire Terrier 27%
  • 0 races
  • Gen 1
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACACGAGTATTACCATACCGATTATTAGCACAC
A
C
A
C
G
A
G
T
A
T
T
A
C
C
A
T
A
C
C
G
A
T
T
A
T
T
A
G
C
A
C
A
C
Genes: 49EF5J9FF6H

Composition

Yorkshire Terrier
27%
French Bulldog
18%
Husky
9%
Shiba Inu
9%
Labrador
9%
Border Collie
9%
Labrador BK
9%
Rottweiler
9%

Current Energy

Vitality -19 points
Lunar Effect +2 points

Traits Breakdown

Body Husky
Tail French Bulldog
Legs Shiba Inu
Front Legs Yorkshire Terrier
Head Labrador
Ears Border Collie
Snout French Bulldog
Mouth Yorkshire Terrier
Nose Yorkshire Terrier
Eyes Labrador BK
Color Rottweiler