Aragorn Anakin Crypto Dog - Mix of Labrador BK, Dachshund, Pug, Shiba Inu, Corgi, Maltese, Rottweiler, Pitbull terrier and German Shepard

Achievements

None
Aragorn Anakin
How goes it? I'm Aragorn Anakin. I'd like to take you for a byte to eat in cyberspace. I'll eat my vomit and yours too. Removing excess stuffing from pillows is my favorite hobby. Blue toilet water turns me off. My bark alone scares birds out of my yard.
  • Purity 3%
  • Age 3 months
  • Racing Exp 0
  • Labrador BK 18%
  • 0 races
  • Gen 1
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GCAGAAGTAAGCACCCACGCAGGATCCTCAGGA
G
C
A
G
A
A
G
T
A
A
G
C
A
C
C
C
A
C
G
C
A
G
G
A
T
C
C
T
C
A
G
G
A
Genes: 62EOKH6AN7A

Composition

Labrador BK
18%
Dachshund
18%
Pug
9%
Shiba Inu
9%
Corgi
9%
Maltese
9%
Rottweiler
9%
Pitbull terrier
9%
German Shepard
9%

Current Energy

Vitality -20 points
Lunar Effect +6 points

Traits Breakdown

Body Labrador BK
Tail Pug
Legs Shiba Inu
Front Legs Corgi
Head Maltese
Ears Rottweiler
Snout Labrador BK
Mouth Dachshund
Nose Pitbull terrier
Eyes German Shepard
Color Dachshund