Macintosh Missy Crypto Dog - Mix of Boxer, Labrador, Schnauzer, Labrador BK, Border Collie and Rottweiler

Achievements

None
Macintosh Missy
I wish I could spend every weekend going camping with my human. All the animals out there smell so funny! It doesn't matter to me which team I play for... I just like tail. I'm not into dog collars, unless you're into S & M. When my human brushes my coat, I get frisky!
  • Purity 13%
  • Age 3 months
  • Racing Exp 0
  • Boxer 36%
  • 0 races
  • Gen 1
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GCAAACTACCCAATAAACAACCCAATACACAAC
G
C
A
A
A
C
T
A
C
C
C
A
A
T
A
A
A
C
A
A
C
C
C
A
A
T
A
C
A
C
A
A
C
Genes: 6GJ5CGG5CHG

Composition

Boxer
36%
Labrador
18%
Schnauzer
18%
Labrador BK
9%
Border Collie
9%
Rottweiler
9%

Current Energy

Vitality -11 points
Lunar Effect -10 points

Traits Breakdown

Body Labrador BK
Tail Boxer
Legs Border Collie
Front Legs Labrador
Head Schnauzer
Ears Boxer
Snout Boxer
Mouth Labrador
Nose Schnauzer
Eyes Rottweiler
Color Boxer

Parents

No Children