Susie-Q Slater Digital Cryptocurrency Dog - Mix of German Shepard, Maltese, Border Collie, Pug, French Bulldog, Yorkshire Terrier, Rottweiler and Schnauzer

Achievements

None
Susie-Q Slater
Yo! I'm Susie-Q Slater and I'd like to rock your world. I run on the information superhighway and haven't been hit by a car yet. If you enjoy growling through fences as much as I do, we should get together. I think it's unfair that the cat gets to poop in a box in the house, but I poop in a shoe ONE TIME and everybody freaks out!!
  • Purity 4%
  • Age 56 days
  • Racing Exp 0
  • German Shepard 18%
  • 0 races
  • Gen 2
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCAGAAACCCGATTATACCACACCATATCATAC
T
C
A
G
A
A
A
C
C
C
G
A
T
T
A
T
A
C
C
A
C
A
C
C
A
T
A
T
C
A
T
A
C
Genes: 72K9FJHKC7J

Composition

German Shepard
18%
Maltese
18%
Border Collie
18%
Pug
9%
French Bulldog
9%
Yorkshire Terrier
9%
Rottweiler
9%
Schnauzer
9%

Current Energy

Vitality -11 points
Lunar Effect 0 points

Traits Breakdown

Body German Shepard
Tail Pug
Legs Maltese
Front Legs French Bulldog
Head Yorkshire Terrier
Ears Border Collie
Snout Rottweiler
Mouth Maltese
Nose Schnauzer
Eyes German Shepard
Color Border Collie

Parents

No Children