Molly Mavis Crypto Game Dog - Mix of Rottweiler, German Shepard, Labrador, St. Bernard, Border Collie, Boxer, Maltese and French Bulldog

Achievements

None
Molly Mavis
Whatcha know, honey. Molly Mavis here. I feel totally safe lying naked on a rug in front of a digital fire, surrounded by firewalls. Long, leisurely walks to catch up on my pee-mail is my favorite thing on Sundays. I hate when my human pretends to throw the ball, but then magically has it behind their back when I go looking for it. It's some kind of sorcery!
  • Purity 9%
  • Age 3 months
  • Racing Exp 0
  • Rottweiler 27%
  • 0 races
  • Gen 1
Make him happy share it to your friend*
Happy & Agile
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCATCACCACACTGATACAACACCCGACACCAC
T
C
A
T
C
A
C
C
A
C
A
C
T
G
A
T
A
C
A
A
C
A
C
C
C
G
A
C
A
C
C
A
C
Genes: 775HBJGK9HH

Composition

Rottweiler
27%
German Shepard
18%
Labrador
9%
St. Bernard
9%
Border Collie
9%
Boxer
9%
Maltese
9%
French Bulldog
9%

Current Energy

Vitality -16 points
Lunar Effect 0 points

Traits Breakdown

Body German Shepard
Tail German Shepard
Legs Labrador
Front Legs Rottweiler
Head St. Bernard
Ears Border Collie
Snout Boxer
Mouth Maltese
Nose French Bulldog
Eyes Rottweiler
Color Rottweiler