Mookie Madison Bitcoin Dog - Mix of Grey Wolf, German Shepard, Border Collie, Labrador, Dachshund, Husky and Schnauzer

Achievements

None
Mookie Madison
The cloud's my neighborhood. I'm going kill that damn Nyan Cat if I can catch it. I love fetching anything my human throws! Chasing anything that will run is so much fun, I could do that all day. I don't like thunder. I usually manage to scare it away with my vicious barks, but it always comes back again! I'm looking for some ruff play. Wanna bite me?
  • Purity 9%
  • Age 57 days
  • Racing Exp 0
  • Grey Wolf 27%
  • 0 races
  • Gen 1
Share it to make him Happy!
Sad & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

  • 0 0 0
0 races    Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCATACCCACCCCCCTACGGAACAATATCACCC
T
C
A
T
A
C
C
C
A
C
C
C
C
C
C
T
A
C
G
G
A
A
C
A
A
T
A
T
C
A
C
C
C
Genes: 7J5LLJA4C7L

Composition

Grey Wolf
27%
German Shepard
18%
Border Collie
18%
Labrador
9%
Dachshund
9%
Husky
9%
Schnauzer
9%

Current Energy

Vitality +25 points
Lunar Effect +8 points

Traits Breakdown

Body German Shepard
Tail Border Collie
Legs Labrador
Front Legs Grey Wolf
Head Grey Wolf
Ears Border Collie
Snout Dachshund
Mouth Husky
Nose Schnauzer
Eyes German Shepard
Color Grey Wolf

Parents

No Children