Hardy Huck Cryptocurrency Dog - Mix of German Shepard, Rottweiler, Boxer, Schnauzer, Husky, Maltese, French Bulldog and Corgi

Achievements

None
Hardy Huck
My name is Hardy Huck and I'd really like to sniff you. This dawg chases mice in a big data warehouse. I hate squeaky toys...when I finally get one to stop making that awful sound, my human buys another! I've always had a crush on Lassie. You may prefer walking, but hey, if a human wants to carry me, I'll let 'em.
  • Purity 8%
  • Age 3 months
  • Racing Exp 0
  • German Shepard 18%
  • 0 races
  • Gen 1
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: TCATCAATACACACAAACAACACCCGAAGCCAC
T
C
A
T
C
A
A
T
A
C
A
C
A
C
A
A
A
C
A
A
C
A
C
C
C
G
A
A
G
C
C
A
C
Genes: 77CH4GGK9OH

Composition

German Shepard
18%
Rottweiler
18%
Boxer
18%
Schnauzer
9%
Husky
9%
Maltese
9%
French Bulldog
9%
Corgi
9%

Current Energy

Vitality -28 points
Lunar Effect 0 points

Traits Breakdown

Body German Shepard
Tail German Shepard
Legs Schnauzer
Front Legs Rottweiler
Head Husky
Ears Boxer
Snout Boxer
Mouth Maltese
Nose French Bulldog
Eyes Corgi
Color Rottweiler