Cyrus Cookie Cryptocurrency Dog - Mix of Labrador BK, Pug, Husky, German Shepard, St. Bernard, Grey Wolf, Maltese, Golder Retriever, Labrador, Boxer and French Bulldog

Achievements

None
Cyrus Cookie
I'm into chasing fast cars, squirrels and my tail. Traipsing through mud puddles on to clean carpets...that's my favorite Saturday plan. I hate it when my humans fool me with a pill in peanut butter! It turns me on when I can show an older dog a new trick.
  • Purity 0%
  • Age 3 months
  • Racing Exp 0
  • Mixed-breed
  • 0 races
  • Gen 1
Make him happy share it to your friend*
Neutral & Lazy
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GCAGAAACATCATGACCCACCAGACCAAACCGA
G
C
A
G
A
A
A
C
A
T
C
A
T
G
A
C
C
C
A
C
C
A
G
A
C
C
A
A
A
C
C
G
A
Genes: 6247BLK85G9

Composition

Labrador BK
9%
Pug
9%
Husky
9%
German Shepard
9%
St. Bernard
9%
Grey Wolf
9%
Maltese
9%
Golder Retriever
9%
Labrador
9%
Boxer
9%
French Bulldog
9%

Current Energy

Vitality -16 points
Lunar Effect +4 points

Traits Breakdown

Body Labrador BK
Tail Pug
Legs Husky
Front Legs German Shepard
Head St. Bernard
Ears Grey Wolf
Snout Maltese
Mouth Golder Retriever
Nose Labrador
Eyes Boxer
Color French Bulldog