Jagger Jago Bitcoin Dog - Mix of Golder Retriever, Beagle, Labrador, Boxer, Labrador BK, St. Bernard and Border Collie

Achievements

None
Jagger Jago
How goes it? I'm Jagger Jago. I hate bubble baths; mud puddles are more my style. I think hamsters and cats are both over-rated. When I can get it, my favorite meal is pepperoni pizza and Milk-Bones. Forget plastic hotdogs...I'm into the classic chew toys like slippers.
  • Purity 8%
  • Age 3 months
  • Racing Exp 0
  • Golder Retriever 18%
  • 0 races
  • Gen 4
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: AGACTAGCACCACTAAGATGACCAAACAACTAC
A
G
A
C
T
A
G
C
A
C
C
A
C
T
A
A
G
A
T
G
A
C
C
A
A
A
C
A
A
C
T
A
C
Genes: 8D65D8B5GGJ

Composition

Golder Retriever
18%
Beagle
18%
Labrador
18%
Boxer
18%
Labrador BK
9%
St. Bernard
9%
Border Collie
9%

Current Energy

Vitality -18 points
Lunar Effect -4 points

Traits Breakdown

Body Golder Retriever
Tail Beagle
Legs Labrador BK
Front Legs Labrador
Head Beagle
Ears Golder Retriever
Snout St. Bernard
Mouth Labrador
Nose Boxer
Eyes Boxer
Color Border Collie