Yardwork Yogi-Bear Crypto Game Dog - Mix of Grey Wolf, Husky, Corgi, Beagle, Poodle and Labrador BK

Achievements

None
Yardwork Yogi-Bear
I live in your digital dreams. I am not above stealing food off humans' plates. After introductory sniffing, I like some licking. If you enjoy growling through fences as much as I do, we should get together. I wish my human would stop putting clothes on me. Don't try to cover my flawless fur!
  • Purity 13%
  • Age 3 months
  • Racing Exp 0
  • Grey Wolf 36%
  • 0 races
  • Gen 1
Make him happy share it to your friend*
Happy & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACAACACCCAGCCTACCCGACCCCGCACCCAGC
A
C
A
A
C
A
C
C
C
A
G
C
C
T
A
C
C
C
G
A
C
C
C
C
G
C
A
C
C
C
A
G
C
Genes: 44LODLIL6LO

Composition

Grey Wolf
36%
Husky
18%
Corgi
18%
Beagle
9%
Poodle
9%
Labrador BK
9%

Current Energy

Vitality -20 points
Lunar Effect -18 points

Traits Breakdown

Body Husky
Tail Husky
Legs Grey Wolf
Front Legs Corgi
Head Beagle
Ears Grey Wolf
Snout Poodle
Mouth Grey Wolf
Nose Labrador BK
Eyes Grey Wolf
Color Corgi