Tango Tyson Litecoin Dog - Mix of Grey Wolf, Husky, Pitbull terrier, German Shepard, Poodle, Labrador BK and Corgi

Achievements

None
Tango Tyson
Ima cyber dog. I love spending my days curled up in a cozy blanket with a nice, fresh bone to chew. What's your favorite bed? Mine is the dirty laundry. I don't understand why my human tries to give me tap water. I expect filtered and distilled! I'm a serial monogamist.
  • Purity 14%
  • Age 3 months
  • Racing Exp 0
  • Grey Wolf 36%
  • 0 races
  • Gen 1
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: ACAACACCCTCCTCACCCGACGCACCCCCCAGC
A
C
A
A
C
A
C
C
C
T
C
C
T
C
A
C
C
C
G
A
C
G
C
A
C
C
C
C
C
C
A
G
C
Genes: 44LN7LI6LLO

Composition

Grey Wolf
36%
Husky
18%
Pitbull terrier
9%
German Shepard
9%
Poodle
9%
Labrador BK
9%
Corgi
9%

Current Energy

Vitality -24 points
Lunar Effect -14 points

Traits Breakdown

Body Husky
Tail Husky
Legs Grey Wolf
Front Legs Pitbull terrier
Head German Shepard
Ears Grey Wolf
Snout Poodle
Mouth Labrador BK
Nose Grey Wolf
Eyes Grey Wolf
Color Corgi